shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LGI4-shRNA-Seq2)(CAT#: AdV-SI0593WQ)

This product is a LGI4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LGI4-shRNA-Seq2
Related Target/Protein LGI4
Region CDS
TargetSeq GATCTACCAGCATCACGAGAT
NCBI RefSeq NM_139284
Alternative Names LGIL3; AMCNMY
Titer >1*10^10 GC/mL
Related Diseases Neurological diseases
Target Gene
Gene ID 163175
Uniprot ID Q8N135

Related Products