shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(MFSD6L-shRNA-Seq1)(CAT#: AdV-SI2941WQ)

This product is a MFSD6L-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of MFSD6L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert MFSD6L-shRNA-Seq1
Related Target/Protein MFSD6L
Region CDS
TargetSeq GAACTTTCTGTTCTGGCACAT
NCBI RefSeq NM_152599
Titer >1*10^10 GC/mL
Target Gene
Gene ID 162387
Uniprot ID Q8IWD5

Related Products