shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(VRTN-shRNA-Seq3)(CAT#: AdV-SI0102WQ)

This product is a VRTN-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert VRTN-shRNA-Seq3
Related Target/Protein VRTN
Region CDS
TargetSeq GTACCCTATCGCTGCTTCAAA
NCBI RefSeq NM_018228
Alternative Names vertnin; C14orf115
Titer >1*10^10 GC/mL
Related Diseases Development of Thoracic Vertebrae in Mammals
Target Gene
Gene ID 55237
Uniprot ID Q9H8Y1

Related Products