shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(MRPL16-shRNA-Seq2)(CAT#: AdV-SI0717WQ)

This product is a MRPL16-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert MRPL16-shRNA-Seq2
Related Target/Protein MRPL16
Region 3UTR
TargetSeq GAAGTCTTTGGGTAGCTCTTA
NCBI RefSeq NM_017840
Alternative Names L16mt; MRP-L16; PNAS-111
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancers
Target Gene
Gene ID 54948
Uniprot ID Q9NX20

Related Products