shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pgm2-shRNA-Seq1)(CAT#: AdV-SI3082WQ)

This product is a Pgm2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Pgm2 gene catalyzes the conversion of the nucleoside breakdown products ribose-1-phosphate and deoxyribose-1-phosphate to the corresponding 5-phosphopentoses and has low glucose 1,6-bisphosphate synthase activity. The expression of Pgm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Pgm2-shRNA-Seq1
Related Target/Protein Pgm2
Region CDS
TargetSeq CGGAACTTCTTTACCAGGTAT
NCBI RefSeq NM_028132
Alternative Names MSTP006
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55276
Uniprot ID Q96G03

Related Products