shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pgm2-shRNA-Seq1)(CAT#: AdV-SI3082WQ)
This product is a Pgm2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Pgm2 gene catalyzes the conversion of the nucleoside breakdown products ribose-1-phosphate and deoxyribose-1-phosphate to the corresponding 5-phosphopentoses and has low glucose 1,6-bisphosphate synthase activity. The expression of Pgm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Pgm2-shRNA-Seq1 |
| Related Target/Protein | Pgm2 |
| Region | CDS |
| TargetSeq | CGGAACTTCTTTACCAGGTAT |
| NCBI RefSeq | NM_028132 |
| Alternative Names | MSTP006 |
| Titer | >1*10^10 GC/mL |