shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pppde1-shRNA-Seq2)(CAT#: AdV-SI2822WQ)

This product is a Pppde1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Pppde1-shRNA-Seq2
Related Target/Protein Pppde1
Region CDS
TargetSeq GAGCTAGGAGAAACATTTAAA
NCBI RefSeq NM_024282
Alternative Names DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51029
Uniprot ID Q9BSY9

Related Products