shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Sash3-shRNA-Seq1)(CAT#: AdV-SI3096WQ)
This product is a Sash3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Sash3 gene contains a Src homology-3 (SH3) domain and a sterile alpha motif (SAM), both of which are found in proteins involved in cell signaling. This protein may function as a signaling adapter protein in lymphocytes. The expression of Sash3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Sash3-shRNA-Seq1 |
| Related Target/Protein | Sash3 |
| Region | 3UTR |
| TargetSeq | CCACTATCCTTCTCAACATTT |
| NCBI RefSeq | NM_028773 |
| Alternative Names | SLY; 753P9; HACS2; CXorf9; SH3D6C |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lymphoma |