shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Tmub1-shRNA-Seq1)(CAT#: AdV-SI3132WQ)

This product is a Tmub1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tmub1-shRNA-Seq1
Related Target/Protein Tmub1
Region 3UTR
TargetSeq CTAGTTTCAAAGAGCTGCCTA
NCBI RefSeq NM_022418
Alternative Names DULP; SB144; C7orf21
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 83590
Uniprot ID Q9BVT8

Related Products