shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Trmt1-shRNA-Seq2)(CAT#: AdV-SI2854WQ)

This product is a Trmt1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Trmt1-shRNA-Seq2
Related Target/Protein Trmt1
Region CDS
TargetSeq GCAAACGATTCAAAGAGGGTA
NCBI RefSeq NM_198020
Alternative Names TRM1; MRT68
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive intellectual disorder (ARID)
Target Gene
Gene ID 55621
Uniprot ID O75648

Related Products