shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Vps13a-shRNA-Seq1)(CAT#: AdV-SI3065WQ)
This product is a Vps13a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Vps13a-shRNA-Seq1 |
| Related Target/Protein | Vps13a |
| Region | CDS |
| TargetSeq | CCGTTTACAGATGTCAGTATT |
| NCBI RefSeq | NM_173028 |
| Alternative Names | CHAC; CHOREIN |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive disorder, chorea-acanthocytosis |