shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Vps13a-shRNA-Seq1)(CAT#: AdV-SI3065WQ)

This product is a Vps13a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Vps13a-shRNA-Seq1
Related Target/Protein Vps13a
Region CDS
TargetSeq CCGTTTACAGATGTCAGTATT
NCBI RefSeq NM_173028
Alternative Names CHAC; CHOREIN
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive disorder, chorea-acanthocytosis
Target Gene
Gene ID 23230
Uniprot ID Q96RL7

Related Products