shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(ANKS6-shRNA-Seq2)(CAT#: AdV-SI1901WQ)
This product is a ANKS6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by ANKS6 gene may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. The expression of ANKS6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | ANKS6-shRNA-Seq2 |
| Related Target/Protein | ANKS6 |
| Region | CDS |
| TargetSeq | GCGATTTCTGAACTGAACGCA |
| NCBI RefSeq | NM_173551 |
| Alternative Names | PKDR1; SAMD6; NPHP16; ANKRD14 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nephronophthisis |