shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CCDC67-shRNA-Seq2)(CAT#: AdV-SI0195WQ)

This product is a CCDC67-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CCDC67-shRNA-Seq2
Related Target/Protein CCDC67
Region CDS
TargetSeq GAACAAATTGACATCATGGTA
NCBI RefSeq NM_181645
Alternative Names DEUP1
Titer >1*10^10 GC/mL
Related Diseases Papillary thyroid carcinoma, gastric cancer
Target Gene
Gene ID 159989
Uniprot ID Q05D60

Related Products