shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Eif4h-shRNA-Seq4)(CAT#: AdV-SI1931WQ)
This product is a Eif4h-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Eif4h-shRNA-Seq4 |
| Related Target/Protein | Eif4h |
| Region | CDS |
| TargetSeq | GACTTCAGAGAACCCACAGAA |
| NCBI RefSeq | NM_033561 |
| Alternative Names | WSCR1; WBSCR1; eIF-4H |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Williams syndrome |