shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DHX15-shRNA-Seq4)(CAT#: AdV-SI0009WQ)
This product is a DHX15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DHX15 is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. Misregulation of this gene has been implicated in tumorigenesis. The expression of DHX15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DHX15-shRNA-Seq4 |
Related Target/Protein | DHX15 |
Region | CDS |
TargetSeq | TGTAAGAGAATAAAGCGTGAA |
NCBI RefSeq | NM_001358 |
Alternative Names | DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute myeloid leukemia (AML) |