shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TEX13B-shRNA-Seq2)(CAT#: AdV-SI0270WQ)
This product is a TEX13B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TEX13B-shRNA-Seq2 |
Related Target/Protein | TEX13B |
Region | CDS |
TargetSeq | GCTTTGCCAAACTGCACAGAT |
NCBI RefSeq | NM_031273 |
Alternative Names | TGC3B; TSGA5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Testis cancer |