shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TMEM60-shRNA-Seq2)(CAT#: AdV-SI0232WQ)

This product is a TMEM60-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of TMEM60-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TMEM60-shRNA-Seq2
Related Target/Protein TMEM60
Region CDS
TargetSeq CGACATGGATCACACAATATT
NCBI RefSeq NM_032936
Alternative Names DC32; C7orf35
Titer >1*10^10 GC/mL
Related Diseases Kidney function and chronic kidney disease
Target Gene
Gene ID 85025
Uniprot ID Q9H2L4

Related Products