shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TREH-shRNA-Seq1)(CAT#: AdV-SI0369WQ)

This product is a TREH-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TREH-shRNA-Seq1
Related Target/Protein TREH
Region CDS
TargetSeq GAATCGCTATTATGTCCCTTA
NCBI RefSeq NM_007180
Alternative Names TRE; TREA; TREHD
Titer >1*10^10 GC/mL
Related Diseases Motoneuron degeneration
Target Gene
Gene ID 11181
Uniprot ID O43280

Related Products