shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TTC21A-shRNA-Seq1)(CAT#: AdV-SI0288WQ)
This product is a TTC21A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC21A-shRNA-Seq1 |
| Related Target/Protein | TTC21A |
| Region | CDS |
| TargetSeq | GCCGTGATCTTGAATCCTGTA |
| NCBI RefSeq | NM_145755 |
| Alternative Names | STI2; SPGF37; IFT139A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Asthenoteratospermia |
