shRNA Lentivirus (self-inactivating), pH1-(Adm2-shRNA-Seq1)(CAT#: LV-SI2811WQ)

This product is a Adm2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Adm2-shRNA-Seq1
Related Target/Protein Adm2
Region 3UTR
TargetSeq CTATGAGGATATGTGGATCTA
NCBI RefSeq NM_182928
Alternative Names AM2; dJ579N16.4
Titer >1*10^10 GC/mL
Related Diseases Gastrointestinal and cardiovascular disease
Target Gene
Gene ID 79924
Uniprot ID Q7Z4H4

Related Products