shRNA Lentivirus (self-inactivating), pH1-(Cyb5d2-shRNA-Seq4)(CAT#: LV-SI2889WQ)

This product is a Cyb5d2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Cyb5d2-shRNA-Seq4
Related Target/Protein Cyb5d2
Region CDS
TargetSeq CGCAGAAAGCAATACTTGGTA
NCBI RefSeq XM_109819
Alternative Names CYB5D2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124936
Uniprot ID Q8WUJ1

Related Products