shRNA Lentivirus (self-inactivating), pH1-(EFCAB4A-shRNA-Seq1)(CAT#: LV-SI0890WQ)
This product is a EFCAB4A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | EFCAB4A-shRNA-Seq1 |
| Related Target/Protein | EFCAB4A |
| Region | CDS |
| TargetSeq | GCTGTTTCTGCTGTGTGACAA |
| NCBI RefSeq | NM_173584 |
| Alternative Names | CRACR2B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Chronic bronchitis |
