shRNA Lentivirus (self-inactivating), pH1-(EFCAB4A-shRNA-Seq2)(CAT#: LV-SI0891WQ)

This product is a EFCAB4A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert EFCAB4A-shRNA-Seq2
Related Target/Protein EFCAB4A
Region CDS
TargetSeq GCAGAAAGAGAAAGTCAGCCT
NCBI RefSeq NM_173584
Alternative Names CRACR2B
Titer >1*10^10 GC/mL
Related Diseases Chronic bronchitis
Target Gene
Gene ID 283229
Uniprot ID Q8N4Y2

Related Products