shRNA Lentivirus (self-inactivating), pH1-(Eif4h-shRNA-Seq4)(CAT#: LV-SI2781WQ)
This product is a Eif4h-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Eif4h-shRNA-Seq4 |
| Related Target/Protein | Eif4h |
| Region | CDS |
| TargetSeq | GACTTCAGAGAACCCACAGAA |
| NCBI RefSeq | NM_033561 |
| Alternative Names | WSCR1; WBSCR1; eIF-4H |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Williams syndrome |