shRNA Lentivirus (self-inactivating), pH1-(Lipk-shRNA-Seq1)(CAT#: LV-SI3078WQ)
This product is a Lipk-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lipk gene plays a highly specific role in the last step of keratinocyte differentiation and may have an essential function in lipid metabolism of the most differentiated epidermal layers. The expression of Lipk-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lipk-shRNA-Seq1 |
| Related Target/Protein | Lipk |
| Region | CDS |
| TargetSeq | CCTTATCTACTACAAGGAGAT |
| NCBI RefSeq | NM_172837 |
| Alternative Names | LIPL2; bA186O14.2 |
| Titer | >1*10^10 GC/mL |