shRNA Lentivirus (self-inactivating), pH1-(Reep4-shRNA-Seq1)(CAT#: LV-SI3177WQ)
This product is a Reep4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Reep4-shRNA-Seq1 |
Related Target/Protein | Reep4 |
Region | 3UTR |
TargetSeq | GCACAGGGAGACATTCACTAT |
NCBI RefSeq | NM_180588 |
Alternative Names | PP432; Yip2c; C8orf20 |
Titer | >1*10^10 GC/mL |