shRNA Lentivirus (self-inactivating), pH1-(Reep4-shRNA-Seq1)(CAT#: LV-SI3177WQ)

Datasheet

This product is a Reep4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Reep4-shRNA-Seq1
Related Target/Protein Reep4
Region 3UTR
TargetSeq GCACAGGGAGACATTCACTAT
NCBI RefSeq NM_180588
Alternative Names PP432; Yip2c; C8orf20
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80346
Uniprot ID Q9H6H4

Related Products

Recombinant lentivirus, pU6-(Human prox1), Overexpression (CAT#:Lenti-GTOH0816WQ) Recombinant lentivirus, pU6-(Human AFP), Overexpression (CAT#:Lenti-GTOH0640WQ) shRNA Lentivirus (self-inactivating), pU6-(C1orf126-shRNA-Seq2) (CAT#:LV-SI2093WQ) shRNA Lentivirus (self-inactivating), p7SK-(TTC1-shRNA-Seq2) (CAT#:LV-SI1147WQ) shRNA Lentivirus (self-inactivating), pH1-(Bex2-shRNA-Seq1) (CAT#:LV-SI3088WQ) shRNA Lentivirus (self-inactivating), pH1-(4932416K20Rik-shRNA-Seq1) (CAT#:LV-SI3172WQ) shRNA Lentivirus (self-inactivating), pU6-(Eif4h-shRNA-Seq4) (CAT#:LV-SI1931WQ) shRNA Lentivirus (self-inactivating), pU6-(RBM33-shRNA-Seq5) (CAT#:LV-SI2109WQ)