shRNA Lentivirus (self-inactivating), pH1-(SPATA19-shRNA-Seq2)(CAT#: LV-SI0666WQ)

This product is a SPATA19-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPATA19 may have a role in spermiogenesis. The expression of SPATA19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPATA19-shRNA-Seq2
Related Target/Protein SPATA19
Region CDS
TargetSeq GCTGTGTCTGTACTACATCAT
NCBI RefSeq NM_174927
Alternative Names CT132; SPAS1; spergen1
Titer >1*10^10 GC/mL
Related Diseases Spermiogenesis
Target Gene
Gene ID 219938
Uniprot ID Q7Z5L4

Related Products