shRNA Lentivirus (self-inactivating), pU6-(LRRN4-shRNA-Seq3)(CAT#: LV-SI1615WQ)
This product is a LRRN4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LRRN4-shRNA-Seq3 |
| Related Target/Protein | LRRN4 |
| Region | CDS |
| TargetSeq | GATGCAAAGAGAACTGTCCTA |
| NCBI RefSeq | NM_152611 |
| Alternative Names | NLRR4; NLRR-4; C20orf75; dJ1056H1.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nervous system disease |