shRNA Lentivirus (self-inactivating), pU6-(SFTA2-shRNA-Seq1)(CAT#: LV-SI0077WQ)

Datasheet

This product is a SFTA2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SFTA2-shRNA-Seq1
Related Target/Protein SFTA2
Region CDS
TargetSeq CGGGTATGACTTTGCAACTGA
NCBI RefSeq NM_205854
Alternative Names SP-G; SFTPG; UNQ541; GSGL541
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 389376
Uniprot ID Q6UW10

Related Products

shRNA Lentivirus (self-inactivating), pH1-(C8orf44-shRNA-Seq1) (CAT#:LV-SI2367WQ) Recombinant lentivirus, pU6-(Human IL10 3'UTR), Overexpression (CAT#:Lenti-GTOH0582WQ) shRNA Lentivirus (self-inactivating), p7SK-(Lamtor2-shRNA-Seq1) (CAT#:LV-SI4046WQ) Recombinant lentivirus, pU6-(Human CDK8 3'UTR), Overexpression (CAT#:Lenti-GTOH0562WQ) shRNA Lentivirus (self-inactivating), pH1-(KIAA1841-shRNA-Seq2) (CAT#:LV-SI0720WQ) Recombinant lentivirus, pU6-(Human hsa-let-7a-1), Overexpression (CAT#:Lenti-GTOH0654WQ) shRNA Lentivirus (self-inactivating), pU6-(PRELID2-shRNA-Seq2) (CAT#:LV-SI0297WQ) shRNA Lentivirus (self-inactivating), pH1-(CCDC116-shRNA-Seq2) (CAT#:LV-SI0608WQ)