shRNA Lentivirus (self-inactivating), pU6-(TRABD-shRNA-Seq1)(CAT#: LV-SI0248WQ)
This product is a TRABD-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TRABD-shRNA-Seq1 |
| Related Target/Protein | TRABD |
| Region | CDS |
| TargetSeq | CGACGTCTACCTAACCTACAT |
| NCBI RefSeq | NM_025204 |
| Alternative Names | LP6054; PP2447 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Graves' Disease |