shRNA Adeno-associated Virus Serotype 2, pH1-(KIAA0930-shRNA-Seq1)(CAT#: AAV-SI0976WQ)

This product is a KIAA0930-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA0930-shRNA-Seq1
Related Target/Protein KIAA0930
Region CDS
TargetSeq CGTCTTCTGGACTTGGATGTT
NCBI RefSeq NM_015264
Alternative Names LSC3; C22orf9
Titer >1*10^10 GC/mL
Related Diseases Melanoma
Target Gene
Gene ID 23313
Uniprot ID Q6ICG6

Related Products