shRNA Adeno-associated Virus Serotype 2, pU6-(ANKRD20A1-shRNA-Seq2)(CAT#: AAV-SI0201WQ)
This product is a ANKRD20A1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of ANKRD20A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ANKRD20A1-shRNA-Seq2 |
| Related Target/Protein | ANKRD20A1 |
| Region | CDS |
| TargetSeq | CAAGTTCACATGCCGTTGATA |
| NCBI RefSeq | NM_032250 |
| Alternative Names | ANKRD20A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Behçet's disease |
