shRNA Adeno-associated Virus Serotype 2, p7SK-(RSBN1-shRNA-Seq1)(CAT#: AAV-SI1075WQ)
This product is a RSBN1-shRNA encoding AAV, which is based on AAV-2 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | RSBN1-shRNA-Seq1 |
Related Target/Protein | RSBN1 |
Region | CDS |
TargetSeq | CGATCTCAAGCACAAGGACAA |
NCBI RefSeq | NM_018364 |
Alternative Names | KDM9; ROSBIN |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |