shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Fam110b-shRNA-Seq1)(CAT#: AdV-SI3913WQ)

This product is a Fam110b-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Fam110b gene may be involved in tumor progression. The expression of Fam110b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fam110b-shRNA-Seq1
Related Target/Protein Fam110b
Region CDS
TargetSeq CAGACTTGAGTGACAGGTATT
NCBI RefSeq NM_173426
Alternative Names C8orf72
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 90362
Uniprot ID Q8TC76

Related Products