shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TTC18-shRNA-Seq1)(CAT#: AdV-SI0613WQ)

This product is a TTC18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TTC18-shRNA-Seq1
Related Target/Protein TTC18
Region CDS
TargetSeq CAAGAGTTCCTCTGGTCACTA
NCBI RefSeq NM_145170
Alternative Names CFAP70
Titer >1*10^10 GC/mL
Related Diseases Outer dynein arm (ODA)
Target Gene
Gene ID 118491
Uniprot ID Q5T0N1

Related Products