Recombinant Lentivirus

As a frontier biotech service provider, Creative Biolabs provides superior recombinant lentivirus products for our clients all over the world. With high standards of quality control, the recombinant lentivirus vectors are able to be used safely in preclinical gene therapy development, including vascular diseases, diabetes mellitus, rheumatoid arthritis and different cancers, etc. We are dedicated to developing first-in-class recombinant lentivirus that best fits your requirements and expedites your development programs.

Our Products

The lentiviral vectors are successful and efficient gene delivery vehicles that are able to provide long-term gene expression and highly effective gene therapy. Currently, the lentiviral vectors, especially the third-generation also known as self-inactivating (SIN) lentiviral vectors have been used in multiple clinical trials to introduce genes into targeted cells. The delivery of chimeric antigen receptors or cloned T-cell receptors using recombinant lentiviral vectors has achieved noteworthy clinical success in B-cell malignancies therapy. It leads to regulatory approval of the first genetically engineered cellular therapy based on the recombinant lentiviral vectors. We also provide state-of-the-art lentivirus vector services from vector construction, characterization, to optimization and purification to meet the demands for basic research and gene therapy development.

Recombinant Lentivirus Introduction

Recombinant lentiviral vectors—a tool used for gene delivery—function entirely as recombinant DNA molecules at two distinct stages:

01 In vitro construction (vector plasmid) - The vector is constructed using molecular cloning techniques, in which viral genes (e.g., gag, pol, and env) are replaced by the gene of interest (GOI), regulatory elements (e.g., promoters), and safety elements (e.g., self-inactivating, or SIN structure). This plasmid carrying the target gene is a recombinant DNA molecule composed of DNA fragments from different genetic sources.

02 In vivo function (provirus) - After infecting target cells, the lentivirus uses its reverse transcriptase to convert the RNA genome into a double-stranded DNA (dsDNA) intermediate. This dsDNA is then randomly and stably integrated into the host cell's nuclear genome by viral integrase. This integrated sequence is called a provirus, which is a recombinant DNA molecule—formed by the fusion of exogenous and endogenous (host) DNA—thereby enabling the long-term stable expression of therapeutic or experimental genes.

Lentivirus Vector Cloning Recombination

Constructing expression vectors involves complex molecular cloning and recombination strategies. The goal is to insert the gene of interest (GOI)—either an open reading frame (ORF) for overexpression or an shRNA/miRNA for gene knockdown—into the vector backbone in a precise and directed manner.

  • Traditional Restriction Enzyme Cloning

This is a traditional method that relies on unique restriction enzyme sites flanking the target gene and within the multiple cloning site (MCS) of the vector. While reliable, this method is time-consuming and carries the risk of introducing frameshift mutations if the restriction enzyme sites are not sufficiently unique.

  • Recombinational Cloning

Researchers often utilize advanced recombinational cloning systems for high-throughput, sequence-independent vector construction. These systems, such as the λ phage-based Gateway cloning technology, utilize site-specific recombination between the target gene (flanked by attL sites) and the recipient vector (flanked by attR sites).

Gene Knockout Recombinant Lentivirus How It Works?

Recombinant lentivirus is a powerful vehicle for achieving Gene Knockout (KO), primarily by delivering components of the CRISPR-Cas9 system. The system leverages the lentivirus's ability to stably integrate genetic material to establish a cell line that constitutively expresses the KO machinery.

01 Lentiviral Vector Delivery: Construct a single lentiviral vector (or a multiple vector system) that simultaneously expresses two core components:

  • Cas9 nuclease
  • sgRNA expression cassette

02 Transduction and Integration: The lentivirus transduces target cells, and the Cas9 and sgRNA expression cassettes are stably integrated into the host genome as a provirus.

03 Constitutive Expression: The cells permanently express the Cas9 protein and the specific sgRNA. Targeting and DSB: The sgRNA guides Cas9 to the target site. Cas9 cleaves the DNA double helix, creating a DSB.

04 Repair and Gene Knockout: The cell attempts to repair the DSB using the non-homologous end joining (NHEJ) pathway, an error-prone process. It repairs typically introduces small random insertions or deletions (indels) at the cleavage site.

Mode of Transmission of Recombinant Lentivirus

For biosafety and application purposes, distinguishing between the transduction of therapeutic vectors and the replication of natural wild-type viruses is crucial.

A. In vivo/In Vitro Transduction (Main Mode)

The designed mode of action for recombinant lentiviruses is transduction, which is the successful delivery of the vector's genetic material (target gene) into target cells. This is achieved through the following steps:

  • Receptor binding: Pseudotyped envelope glycoproteins (e.g., VSV-G) bind to receptors universally expressed on the surface of target cells.
  • Membrane fusion and entry: The viral particle enters the cell via endocytosis, followed by fusion of the viral membrane with the endosomal membrane, releasing the viral core into the cytoplasm.
  • Reverse transcription and integration: The genetic material is converted into double-stranded DNA (provirus) and stably integrated into the host genome.

B. Prevention of Horizontal Transmission (Biosafety)

Three-plasmid or four-plasmid packaging systems are designed to prevent the generation of replication-competent viruses (RCVs)—a major biosafety concern.

  • Gene separation: Essential viral genes are physically separated onto different plasmids. The probability of three or four independent recombination events occurring simultaneously in a single production cell to reconstitute a complete, infectious, and transmissible wild-type genome is statistically negligible.
  • Self-inactivating (SIN) LTR: Most modern lentiviral vectors contain a deletion in the 3' LTR, rendering the final integrated provirus unable to initiate subsequent transcription and vector packaging. This prevents the formation of any potential replication intermediates, effectively eliminating the risk of horizontal transmission to neighboring cells or organisms.

Types of Recombinant Lentivirus

Type Key Features Primary Applications
First Generation Contained all accessory genes (vif, vpr, vpu, nef). High expression, but higher potential for RCV production. Historical/Early research. Largely superseded.
Second Generation Deleted all accessory genes, only gag, pol, rev retained in packaging. Significant improvement in safety. Standard research and in vitro applications.
Third Generation Further split the packaging system, removing rev from the primary packaging plasmid and placing it on a separate plasmid. Used a modified 5' LTR. Highest safety profile. ex vivo gene therapy, sensitive in vivo studies, CAR T-cell manufacturing.
Non-Integrative Lentivirus (NILV) Engineered with a modified integrase or LTRs to prevent stable integration. The provirus remains as an episome. Transient expression, vaccination, applications where stable integration is undesirable or risky.
Pseudotyped VSV-G Most common. VSV-G envelope confers broad tropism and high physical stability. General research, ex vivo transduction, large-scale production.
Pseudotyped with Retargeted Envelopes Engineered envelopes (e.g., to target specific receptors like CD34) or fusion proteins. Targeted in vivo delivery, organ-specific tropism.

Applications of Recombinant Lentivirus

Functional Genomics

Systematically investigating gene function in different biological contexts through gene overexpression, gene silencing, or gene mutation studies.

Drug Discovery

Utilizing genetically engineered cell models for target validation, high-throughput screening, and mechanism of action studies.

Disease Modeling

Constructing cell models that mimic pathological states by introducing disease-associated mutations or expressing pathogenic factors.

Stem Cell Research

Genetically modifying pluripotent and adult stem cells for applications in developmental biology, differentiation studies, and regenerative medicine.

Biomanufacturing

Developing cell lines for the production of therapeutic proteins, antibodies, and other important biomolecules.

Neuroscience Applications

Genetically manipulating neuronal populations for neural circuit mapping, functional studies, and modeling of nervous system diseases.

Why Choose Our Products?

  • Superior Production Methods: Advanced transfection techniques and optimized culture conditions yield high-titer preparations with minimal empty viral particles.
  • Rigorous Quality Control: Comprehensive testing includes sterility assessment, mycoplasma screening, endotoxin testing, and functional validation on multiple cell types.
  • Custom Engineering Capabilities: Flexible vector design services meet diverse experimental needs, including promoter selection, reporter gene introduction, and specific envelope pseudotyping.
  • Enhanced Safety Features: Utilizing a third-generation safety design incorporating independent transcription units and self-inactivating structures to minimize biological risk.


Frequently Asked Questions

Q: How stable are the viral preparations? What are the recommended storage conditions?

A: Viral particles remain functionally stable when stored at -80°C in an appropriate cryopreservation solution. Under these conditions, the preparations typically maintain over 80% of their initial activity for up to 24 months. For best results, we recommend avoiding repeated freeze-thaw cycles and using single-use aliquots. During transportation, using specialized dry ice shipping containers at temperatures below -60°C ensures product integrity.

Q: How do this viral vector systems compare to other gene delivery methods?

A: Compared to chemical transfection or electroporation, viral vectors offer significantly higher efficiency in difficult-to-transfect cells, including primary cultured cells and stem cells. Unlike adenoviral systems, our vectors provide sustained, long-term expression through genomic integration. Compared to adeno-associated viruses, they can accommodate larger gene payloads while maintaining high transduction efficiency across various cell types.

Q: What is the typical turnaround time from order placement to product delivery?

A: We offer expedited services for urgent research needs, reducing processing time by 30-40% while maintaining all quality standards.

Q: Can these vectors be used for in vivo applications? What factors need to be considered?

A: Yes, our vectors are suitable for in vivo research, but require appropriate institutional approval. Key considerations include optimization of the delivery route, management of the host organism's immune response, and careful dose titration. We offer expert consulting services for in vivo applications, including biodistribution analysis and expression kinetics analysis.

Creative Biolabs is a leader in this field, offering custom vector design, ultra-high titer production, and rigorous quality control to meet the high standards required for modern research and emerging gene therapies. Partner with Creative Biolabs to ensure exceptional vector quality and scientific support for your next gene therapy or functional genomics project. Should you need further information, please feel free to contact us by E-mail for a quote and further discussion with our scientists.

Reference

  1. Arsenijevic Y, Berger A, Udry F, et al. Lentiviral vectors for ocular gene therapy. Pharmaceutics, 2022, 14(8): 1605. https://doi.org/10.3390/pharmaceutics14081605 (Distributed under Open Access license CC BY 4.0, without modification.)

For research use only. Not intended for any clinical use.
shRNA Lentivirus (self-inactivating), pU6-(OR13F1-shRNA-Seq3) (CAT#: LV-SI1641WQ)
Backbone: Lenti-SIN
TargetSeq: CCCATGCCAATGCTACTCATT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR13F1-shRNA-Seq4) (CAT#: LV-SI1642WQ)
Backbone: Lenti-SIN
TargetSeq: CCTGAGTATGTTCCTGAAGAA
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR13F1-shRNA-Seq5) (CAT#: LV-SI1643WQ)
Backbone: Lenti-SIN
TargetSeq: GCATCATCAATCATTTCACTT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq1) (CAT#: LV-SI1644WQ)
Backbone: Lenti-SIN
TargetSeq: GATCCAGATGGTGGTAGTAAT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq2) (CAT#: LV-SI1645WQ)
Backbone: Lenti-SIN
TargetSeq: CCTGTTTGAGAAGGTGATATT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq3) (CAT#: LV-SI1646WQ)
Backbone: Lenti-SIN
TargetSeq: CCTCCTCATCTTCCTCATCTA
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq4) (CAT#: LV-SI1647WQ)
Backbone: Lenti-SIN
TargetSeq: GAGGAAGGTGAACCATTTCTT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq5) (CAT#: LV-SI1648WQ)
Backbone: Lenti-SIN
TargetSeq: CTTCATGCTTCTCTTCCCATT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq1) (CAT#: LV-SI1649WQ)
Backbone: Lenti-SIN
TargetSeq: GCTCTCCTTCTGTAGATCCAA
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq2) (CAT#: LV-SI1650WQ)
Backbone: Lenti-SIN
TargetSeq: CCACCATGACAACAAATGTAT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq3) (CAT#: LV-SI1651WQ)
Backbone: Lenti-SIN
TargetSeq: GACAGGAATCTTTATGTACTT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq4) (CAT#: LV-SI1652WQ)
Backbone: Lenti-SIN
TargetSeq: CCACTCTTCATAGTCTTCCTT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq1) (CAT#: LV-SI1653WQ)
Backbone: Lenti-SIN
TargetSeq: CTAGGAAATGGCACCATTCTT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq2) (CAT#: LV-SI1654WQ)
Backbone: Lenti-SIN
TargetSeq: CATCCACAATCCTCTGAGATA
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq3) (CAT#: LV-SI1655WQ)
Backbone: Lenti-SIN
TargetSeq: CACCTTCTTCTTGGTTGGGAT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq4) (CAT#: LV-SI1656WQ)
Backbone: Lenti-SIN
TargetSeq: GATCATCTTCTACCTGCCCAT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR51A2-shRNA-Seq5) (CAT#: LV-SI1657WQ)
Backbone: Lenti-SIN
TargetSeq: GTACCGGGAATTGCATCCAAA
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR4L1-shRNA-Seq1) (CAT#: LV-SI1658WQ)
Backbone: Lenti-SIN
TargetSeq: GCGATACTTTCATGGATAATT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR4L1-shRNA-Seq2) (CAT#: LV-SI1659WQ)
Backbone: Lenti-SIN
TargetSeq: GCTTGTTTCTTACATTGTCAT
Promoter: pU6
Type of Insert: shRNA
shRNA Lentivirus (self-inactivating), pU6-(OR4L1-shRNA-Seq3) (CAT#: LV-SI1660WQ)
Backbone: Lenti-SIN
TargetSeq: CCAGATGTTCTTCATGCACTT
Promoter: pU6
Type of Insert: shRNA