shRNA Lentivirus (self-inactivating), p7SK-(2810403A07Rik-shRNA-Seq1)(CAT#: LV-SI4039WQ)
This product is a 2810403A07Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2810403A07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 2810403A07Rik-shRNA-Seq1 |
| Related Target/Protein | 2810403A07Rik |
| Region | 3UTR |
| TargetSeq | GCATTCTTTCTTTACTGGGAT |
| NCBI RefSeq | NM_028814 |
| Alternative Names | Blom7; AI256352; AI451678; Kiaa0907; Khdc4; A430106P18Rik |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 74200 |
| Uniprot ID | A0A0G2JEG2 |