shRNA Lentivirus (self-inactivating), p7SK-(2810403A07Rik-shRNA-Seq1)(CAT#: LV-SI4039WQ)

This product is a 2810403A07Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2810403A07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2810403A07Rik-shRNA-Seq1
Related Target/Protein 2810403A07Rik
Region 3UTR
TargetSeq GCATTCTTTCTTTACTGGGAT
NCBI RefSeq NM_028814
Alternative Names Blom7; AI256352; AI451678; Kiaa0907; Khdc4; A430106P18Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 74200
Uniprot ID A0A0G2JEG2

Related Products