shRNA Lentivirus (self-inactivating), pU6-(OR1N1-shRNA-Seq2)(CAT#: LV-SI1606WQ)

This product is a OR1N1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR1N1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR1N1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR1N1-shRNA-Seq2
Related Target/Protein OR1N1
Region CDS
TargetSeq CCTCACGCAAATGTATTTCTT
NCBI RefSeq XM_071152
Alternative Names OR1N3; OR1-26; OR9-22
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 138883
Uniprot ID Q8NGS0

Related Products