shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Mto1-shRNA-Seq1)(CAT#: AdV-SI4024WQ)
This product is a Mto1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Mto1-shRNA-Seq1 |
| Related Target/Protein | Mto1 |
| Region | CDS |
| TargetSeq | CAAAGTGCTAAACCGGCGTAA |
| NCBI RefSeq | NM_026658 |
| Alternative Names | CGI-02; COXPD10 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Deafness |
