shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C6orf165-shRNA-Seq3)(CAT#: AdV-SI0964WQ)

This product is a C6orf165-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C6orf165 gene may regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C6orf165-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C6orf165-shRNA-Seq3
Related Target/Protein C6orf165
Region 3UTR
TargetSeq GTCTCAAACTTGTGGCTTCAA
NCBI RefSeq NM_178823
Alternative Names CFAP206; dJ382I10.1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 154313
Uniprot ID Q8IYR0

Related Products