shRNA Lentivirus (self-inactivating), p7SK-(AI837181-shRNA-Seq2)(CAT#: LV-SI3531WQ)

Datasheet

This product is a AI837181-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of AI837181-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert AI837181-shRNA-Seq2
Related Target/Protein AI837181
Region CDS
TargetSeq GCTCACTTACAAACCTGATGT
NCBI RefSeq NM_134149
Alternative Names Bles03; N28173
Titer >1*10^10 GC/mL
Target Gene
Gene ID 107242
Uniprot ID Q8VD62

Related Products

Recombinant lentivirus, pU6-(Rabbit SOX9), Overexpression (CAT#:Lenti-GTOH0602WQ) Recombinant lentivirus, pU6-(Human hsa-mir-193b), Overexpression (CAT#:Lenti-GTOH0234WQ) shRNA Lentivirus (self-inactivating), p7SK-(WDR74-shRNA-Seq1) (CAT#:LV-SI1453WQ) Recombinant lentivirus, pU6-(Human EMC6), Overexpression (CAT#:Lenti-GTOH0668WQ) shRNA Lentivirus (self-inactivating), p7SK-(TMEM167B-shRNA-Seq2) (CAT#:LV-SI3205WQ) shRNA Lentivirus (self-inactivating), pU6-(WDR62-shRNA-Seq1) (CAT#:LV-SI2099WQ) shRNA Lentivirus (self-inactivating), pH1-(C16orf62-shRNA-Seq2) (CAT#:LV-SI0987WQ) shRNA Lentivirus (self-inactivating), pU6-(SPAG17-shRNA-Seq1) (CAT#:LV-SI0221WQ)