shRNA Lentivirus (self-inactivating), p7SK-(BC003266-shRNA-Seq1)(CAT#: LV-SI3998WQ)
This product is a Smim12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Smim12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | BC003266-shRNA-Seq1 |
| Related Target/Protein | BC003266 |
| Region | 3UTR |
| TargetSeq | CCTGTGTGCATTCTTCCCTTT |
| NCBI RefSeq | NM_030252 |
| Alternative Names | Smim12 |
| Titer | >1*10^10 GC/mL |
