shRNA Lentivirus (self-inactivating), p7SK-(Reep4-shRNA-Seq1)(CAT#: LV-SI4027WQ)
This product is a Reep4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Reep4 gene probably acts by clearing the endoplasmic reticulum membrane from metaphase chromosomes. The expression of Reep4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Reep4-shRNA-Seq1 |
| Related Target/Protein | Reep4 |
| Region | 3UTR |
| TargetSeq | GCACAGGGAGACATTCACTAT |
| NCBI RefSeq | NM_180588 |
| Alternative Names | PP432; Yip2c; C8orf20 |
| Titer | >1*10^10 GC/mL |
