shRNA Lentivirus (self-inactivating), p7SK-(WDR46-shRNA-Seq3)(CAT#: LV-SI1497WQ)

This product is a WDR46-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert WDR46-shRNA-Seq3
Related Target/Protein WDR46
Region CDS
TargetSeq CTTCAGAAACAGGGTTTCTAA
NCBI RefSeq NM_005452
Alternative Names UTP7; BING4; FP221; C6orf11
Titer >1*10^10 GC/mL
Related Diseases Respiratory Disease
Target Gene
Gene ID 9277
Uniprot ID O15213

Related Products