shRNA Lentivirus (self-inactivating), pH1-(C3orf52-shRNA-Seq1)(CAT#: LV-SI0772WQ)
This product is a C3orf52-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C3orf52 encoded protein is a TPA-induced transmembrane protein. The expression of C3orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C3orf52-shRNA-Seq1 |
| Related Target/Protein | C3orf52 |
| Region | CDS |
| TargetSeq | GCTTATGTCTTGCTGCAGTAA |
| NCBI RefSeq | NM_024616 |
| Alternative Names | TTMP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |