shRNA Lentivirus (self-inactivating), pH1-(FANCI-shRNA-Seq1)(CAT#: LV-SI0839WQ)
This product is a FANCI-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FANCI-shRNA-Seq1 |
| Related Target/Protein | FANCI |
| Region | CDS |
| TargetSeq | CCCTGTGTTATTCTTTCATTT |
| NCBI RefSeq | NM_018193 |
| Alternative Names | KIAA1794 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA Damage |