shRNA Lentivirus (self-inactivating), pH1-(OR5M8-shRNA-Seq4)(CAT#: LV-SI2412WQ)

This product is a OR5M8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR5M8 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5M8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR5M8-shRNA-Seq4
Related Target/Protein OR5M8
Region CDS
TargetSeq GACTCCAAAGATGCTGGAGAT
NCBI RefSeq XM_166835
Alternative Names OR11-194
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 219484
Uniprot ID Q8NGP6

Related Products