shRNA Lentivirus (self-inactivating), pH1-(SESN3-shRNA-Seq2)(CAT#: LV-SI2564WQ)
This product is a SESN3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SESN3-shRNA-Seq2 |
| Related Target/Protein | SESN3 |
| Region | CDS |
| TargetSeq | GCTGAACTTCTTTATGCTCTT |
| NCBI RefSeq | NM_144665 |
| Alternative Names | SEST3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity |