shRNA Lentivirus (self-inactivating), pH1-(TMEM60-shRNA-Seq1)(CAT#: LV-SI0732WQ)
This product is a TMEM60-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of TMEM60-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM60-shRNA-Seq1 |
| Related Target/Protein | TMEM60 |
| Region | CDS |
| TargetSeq | GCTTTAACAGAACTCGGATAT |
| NCBI RefSeq | NM_032936 |
| Alternative Names | DC32; C7orf35 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Kidney function and chronic kidney disease |
