shRNA Lentivirus (self-inactivating), pU6-(LOC80154-shRNA-Seq1)(CAT#: LV-SI0250WQ)
This product is a LOC80154-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC80154-shRNA-Seq1 |
| Related Target/Protein | LOC80154 |
| Region | CDS |
| TargetSeq | GAGAAGCTGCAGGAAAGTACA |
| NCBI RefSeq | NM_025084 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Laryngeal cancer |
