shRNA Lentivirus (self-inactivating), pU6-(OR5B3-shRNA-Seq6)(CAT#: LV-SI2123WQ)

This product is a OR5B3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR5B3 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5B3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR5B3-shRNA-Seq6
Related Target/Protein OR5B3
Region CDS
TargetSeq GCTGCTCAAATGTATATCTTT
NCBI RefSeq NM_001005469
Alternative Names OR5B13; OST129; OR11-239
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 441608
Uniprot ID Q8NH48

Related Products